cpaA [2020-06-03 10:44:48]

K⁺/H⁺ antiporter

Locus: BSU_11640

Isoelectric point: 5.25

Molecular weight: 67.29 kDa

Protein length: 614 aa

Gene length: 1845 bp

Function: export of potassium ions

Product: K⁺/H⁺ antiporter

Essential: no

Synonyms: yjbQ

Genomic Context

Loading

Categories containing this gene/protein

• Cellular processes → Homeostasis → Metal ion homeostasis (K, Na, Ca, Mg) → Potassium uptake/ export
• Information processing → Targets of second messengers → Targets of c-di-AMP
• Groups of genes → Membrane proteins

Gene

Coordinates: 1,240,356 1,242,200

The protein

Protein family

• Monovalent cation:proton antiporter 2 (CPA2) transporter (TC 2.A.37) family (with KhtU, according to UniProt)

Domains

• contains a RCK_N domain (aa 403-525) (according to UniProt)
• contains a RCK_C domain at the C-terminus (aa 533-614) (according to UniProt)

Effectors of protein activity

• binds c-di-AMP, which likely activates export activity PubMed

Structure

• 4BWZ (from Thermus thermophilus, corresponds to the transmembrane domain (aa 27 ... 402), 26% identity) PubMed
• 4YS2 (S. aureus CpaA, the RCK_C domain in complex with c-di-AMP, 58% identity)

Localization

• cell membrane (according to UniProt)

Expression and Regulation

Operons

• Genes: cpaA
  Description: PubMed

Biological materials

Mutant

• MGNA-B163 (yjbQ::erm), available at the NBRP B. subtilis, Japan
• GP2082 (cpaA::ermC), available in Jörg Stülke's lab
• BKE11640 (cpaA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAATCAGAACCTCCTTTT, downstream forward: _UP4_TAAATCTTGACCAAATAAGG
• BKK11640 (cpaA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAATCAGAACCTCCTTTT, downstream forward: _UP4_TAAATCTTGACCAAATAAGG

Expression vectors

• pGP2909 (N-terminal His-tag, purification from E. coli, in pWH844), available in Jörg Stülke's lab

FLAG-tag construct

• GP2438 yjbQ-3xFLAG spc (based on pGP1331), available in Jörg Stülke's lab

References

Reviews

Loading

Original publications

Loading